SCO2, synthesis of cytochrome C oxidase 2, 9997

N. diseases: 294; N. variants: 72
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1064792889
rs1064792889 		1.000 22 50525908 frameshift variant C/- delins
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2011 2011
dbSNP: rs1064792890
rs1064792890 		1.000 22 50525873 frameshift variant CTGAGCGCGGGGCCGTCCCG/- delins
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2005 2005
dbSNP: rs1064792891
rs1064792891 		1.000 22 50525819 inframe deletion AATGGC/- del
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2011 2011
dbSNP: rs1064792892
rs1064792892 		1.000 22 50526386 frameshift variant AGGGCCGAGC/TT delins
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2011 2011
dbSNP: rs11479
rs11479 		0.925 0.080 22 50525807 stop gained G/A;C;T snv 0.13; 1.3E-05; 4.3E-06
CUI: C0685938
Disease: Malignant neoplasm of gastrointestinal tract
Malignant neoplasm of gastrointestinal tract 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2014 2014
dbSNP: rs11479
rs11479 		0.925 0.080 22 50525807 stop gained G/A;C;T snv 0.13; 1.3E-05; 4.3E-06
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2007 2007
dbSNP: rs1178421926
rs1178421926 		1.000 22 50526695 missense variant A/G snv
CUI: C0872218
Disease: MITOCHONDRIAL NEUROGASTROINTESTINAL ENCEPHALOPATHY SYNDROME
MITOCHONDRIAL NEUROGASTROINTESTINAL ENCEPHALOPATHY SYNDROME 		0.010 1.000 1 2013 2013
dbSNP: rs12148
rs12148 		22 50523779 synonymous variant T/A;G snv 0.64
CUI: C4528257
Disease: Corpuscular Hemoglobin Concentration Mean
Corpuscular Hemoglobin Concentration Mean 		0.700 1.000 1 2012 2012
dbSNP: rs12148
rs12148 		22 50523779 synonymous variant T/A;G snv 0.64
CUI: C0014772
Disease: Red Blood Cell Count measurement
Red Blood Cell Count measurement 		0.700 1.000 1 2009 2009
dbSNP: rs131801
rs131801 		22 50528205 non coding transcript exon variant G/A;T snv
CUI: C1304746
Disease: RDW - Red blood cell distribution width result
RDW - Red blood cell distribution width result 		0.700 1.000 1 2016 2016
dbSNP: rs131801
rs131801 		22 50528205 non coding transcript exon variant G/A;T snv
CUI: C0427460
Disease: Red cell distribution width determination
Red cell distribution width determination 		0.700 1.000 1 2016 2016
dbSNP: rs140523
rs140523 		22 50524353 missense variant C/A;G;T snv 1.7E-05; 0.64; 1.7E-05
CUI: C0014772
Disease: Red Blood Cell Count measurement
Red Blood Cell Count measurement 		0.700 1.000 1 2009 2009
dbSNP: rs140523
rs140523 		22 50524353 missense variant C/A;G;T snv 1.7E-05; 0.64; 1.7E-05
CUI: C4528257
Disease: Corpuscular Hemoglobin Concentration Mean
Corpuscular Hemoglobin Concentration Mean 		0.700 1.000 1 2012 2012
dbSNP: rs150742660
rs150742660 		0.925 0.080 22 50523735 missense variant A/G snv 8.0E-06
CUI: C4722085
Disease: Malignant neoplasm of colon and/or rectum
Malignant neoplasm of colon and/or rectum 		0.010 < 0.001 1 2007 2007
dbSNP: rs150742660
rs150742660 		0.925 0.080 22 50523735 missense variant A/G snv 8.0E-06
CUI: C0009402
Disease: Colorectal Carcinoma
Colorectal Carcinoma 		Digestive System Diseases; Neoplasms 0.010 < 0.001 1 2007 2007
dbSNP: rs150742660
rs150742660 		0.925 0.080 22 50523735 missense variant A/G snv 8.0E-06
CUI: C0027651
Disease: Neoplasms
Neoplasms 		Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs1556486029
rs1556486029 		1.000 22 50525867 frameshift variant -/G delins
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 1999 1999
dbSNP: rs1556486467
rs1556486467 		1.000 22 50526089 frameshift variant -/A delins
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2004 2004
dbSNP: rs759452074
rs759452074 		0.925 0.200 22 50523835 missense variant C/A;T snv 8.0E-06; 3.2E-05
CUI: C0023264
Disease: Leigh Disease
Leigh Disease 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Nervous System Diseases 0.700 1.000 1 2016 2016
dbSNP: rs764275775
rs764275775 		1.000 22 50525859 missense variant C/A;G snv
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2011 2011
dbSNP: rs770277446
rs770277446 		1.000 22 50526244 splice donor variant A/G;T snv
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2003 2003
dbSNP: rs773785934
rs773785934 		1.000 22 50525919 splice acceptor variant C/A;T snv 9.2E-06
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 1999 1999
dbSNP: rs866001342
rs866001342 		1.000 22 50526648 stop gained C/A;T snv
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2005 2005
dbSNP: rs892141220
rs892141220 		1.000 22 50526467 missense variant A/G snv
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 1.000 1 2004 2004
dbSNP: rs1064792875
rs1064792875 		1.000 22 50525908 stop gained C/T snv
CUI: C4551995
Disease: Mitochondrial DNA Depletion Syndrome 1
Mitochondrial DNA Depletion Syndrome 1 		0.700 0