| Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
0.050 | GeneticVariation | BEFREE | FOXL2 402C>G Mutation Can Be Identified in the Circulating Tumor DNA of Patients with Adult-Type Granulosa Cell Tumor. | 27810330 | 2017 | |||||||
|
|
|
0.050 | GeneticVariation | BEFREE | We identified 340 patients with the FOXL2 mutation (c.402C>G) and determined that the incidence of the mutation is 91.9% in AGCT patients. | 24257635 | 2013 | |||||||
|
|
|
0.050 | GeneticVariation | BEFREE | Recent molecular studies have characterized the FOXL2 402C > G mutation in adult-type granulosa cell tumor. | 25297715 | 2014 | |||||||
|
|
|
0.050 | GeneticVariation | BEFREE | Differential apoptotic activities of wild-type FOXL2 and the adult-type granulosa cell tumor-associated mutant FOXL2 (C134W). | 21119601 | 2011 | |||||||
|
|
|
0.050 | GeneticVariation | BEFREE | Absence of a FOXL2 mutation (402C→G) in the blood of adult-type granulosa cell tumor patients possessing the FOXL2 mutation. | 21051974 | 2010 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | Functional exploration of the adult ovarian granulosa cell tumor-associated somatic FOXL2 mutation p.Cys134Trp (c.402C>G). | 20098707 | 2010 | |||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TGGGGGTGCGGCGGAGGC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GGCGGCGGT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CGCGGCTGCAGCCGCAGCTGCTGCAGCCGCT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GGCTGCAGCCGCAGCTGCTGCAGCCGCAGCT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TGGCGATGAGCGCCAC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Sporadic and familial blepharophimosis -ptosis-epicanthus inversus syndrome: FOXL2 mutation screen and MRI study of the superior levator eyelid muscle. | 12630957 | 2003 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Mutations in FOXL2 underlying BPES (types 1 and 2) in Colombian families. | 12400065 | 2002 |