CDC73, cell division cycle 73, 79577

N. diseases: 144; N. variants: 31
Disease: Parathyroid Gland Adenocarcinoma ×
Source: ALL
Variant Gene Disease Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs1558276082
rs1558276082
Entrez Id: 79577;101929160
Gene Symbol: CDC73;LOC101929160
CDC73;LOC101929160
CUI: C0687150
Disease:
Parathyroid Gland Adenocarcinoma 		CGTGCTTAGCGTCCTGCGACA 0.700 CausalMutation CLINVAR Cell division cycle protein 73 homolog (CDC73) mutations in the hyperparathyroidism-jaw tumor syndrome (HPT-JT) and parathyroid tumors. 20052758 2010