SCO2, synthesis of cytochrome C oxidase 2, 9997

N. diseases: 294; N. variants: 72
Disease: Cardiomyopathy, Dilated ×
Source: ALL
Variant Gene Disease Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs749838192
rs749838192
Entrez Id: 9997;29781
Gene Symbol: SCO2;NCAPH2
SCO2;NCAPH2
CUI: C0007193
Disease:
Cardiomyopathy, Dilated 		CTGAGTCACTGCTGCATGCT 0.700 GeneticVariation CLINVAR A novel mutation in the SCO2 gene in a neonate with early-onset cardioencephalomyopathy. 20159436 2010