Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Num. diseases
rs104893989 0.878 0.107 6 45431963 missense variant T/C,G snp 2.0E-05 3
rs104893990 0.878 0.107 6 45432011 missense variant G/A snp 3
rs104893991 0.878 0.107 6 45438040 missense variant G/A snp 3
rs104893992 0.878 0.107 6 45438039 missense variant C/T snp 3
rs104893993 0.878 0.107 6 45437964 missense variant A/G snp 3
rs104893995 0.878 0.107 6 45431945 missense variant G/A,C snp 4.0E-06 3
rs201647225 0.878 0.107 6 45431962 missense variant A/G snp 1.1E-04 3
rs752933596 0.878 0.107 6 45438020 missense variant A/T snp 3
rs104893988 1.000 0.071 6 45512277 stop gained G/A snp 1
rs104893994 1.000 0.071 6 45547304 stop lost G/C snp 1
rs397515537 1.000 0.071 6 45546910 stop gained C/T snp 1
rs397515538 1.000 0.071 6 45422624 frameshift variant C/CC in-del 1
rs730880313 1.000 0.071 6 45422723 frameshift variant AGCAGCAACAGCAGCA/AACAGCAGCAGCAGCAGCAGCAACAGCAGCCG in-del 1
rs730880315 1.000 0.071 6 45546967 frameshift variant C/CC in-del 1
rs864621970 1.000 0.071 6 45431915 missense variant G/A snp 1