Source: ALL

Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs429358
rs429358
0.630 0.321 19 44908684 missense variant T/C snp 0.14 0.16
CUI: C0002395
Disease: Alzheimer's Disease
Alzheimer's Disease
0.820 1.000 4 2011 2015
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
Low density lipoprotein cholesterol measurement
0.800 7 2011 2017
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C1445957
Disease: Serum total cholesterol measurement
Serum total cholesterol measurement
0.800 6 2012 2017
dbSNP: rs121918393
rs121918393
0.784 0.071 19 44908756 missense variant C/A,T snp 1.3E-05; 9.0E-05
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.800 4 1987 2012
dbSNP: rs121918394
rs121918394
0.784 0.071 19 44908786 missense variant A/C,G snp 6.5E-06
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.800 4 1983 1995
dbSNP: rs121918397
rs121918397
0.923 0.143 19 44908784 missense variant G/A,C snp 6.5E-06
CUI: C2673196
Disease: LIPOPROTEIN GLOMERULOPATHY
LIPOPROTEIN GLOMERULOPATHY
0.800 2 1997 2000
dbSNP: rs121918399
rs121918399
0.923 0.107 19 44907843 missense variant C/T snp 8.0E-06
CUI: C2673196
Disease: LIPOPROTEIN GLOMERULOPATHY
LIPOPROTEIN GLOMERULOPATHY
0.800 2 1999 2007
dbSNP: rs769455
rs769455
0.769 0.071 19 44908783 missense variant C/T snp 1.4E-03 5.5E-03
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.800 2 1983 1988
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C0523744
Disease: Lipids measurement
Lipids measurement
0.800 1 2012 2012
dbSNP: rs769449
rs769449
0.878 0.107 19 44906745 non coding transcript exon variant G/A snp 9.1E-02
CUI: C0002395
Disease: Alzheimer's Disease
Alzheimer's Disease
0.800 1 2013 2013
dbSNP: rs769449
rs769449
0.878 0.107 19 44906745 non coding transcript exon variant G/A snp 9.1E-02
CUI: C0201657
Disease: C-reactive protein measurement
C-reactive protein measurement
0.800 1 2008 2008
dbSNP: rs405509
rs405509
0.744 0.286 19 44905579 intergenic variant T/G snp 0.58
CUI: C0002395
Disease: Alzheimer's Disease
Alzheimer's Disease
0.740 1.000 12 2009 2017
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C1956346
Disease: Coronary Artery Disease
Coronary Artery Disease
0.710 1.000 3 2013 2018
dbSNP: rs405509
rs405509
0.744 0.286 19 44905579 intergenic variant T/G snp 0.58
Diabetes Mellitus, Non-Insulin-Dependent
0.710 1.000 2 2009 2012
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C0027051
Disease: Myocardial Infarction
Myocardial Infarction
0.710 1.000 2 2010 2017
dbSNP: rs397514254
rs397514254
1.000 0.071 19 44908731 inframe insertion C/CGAGGTGCAGGCCATGCTCGGC in-del
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.700 4 1983 2004
dbSNP: rs121918396
rs121918396
1.000 0.071 19 44908979 stop gained G/A snp 1.6E-05
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.700 3 1982 1993
dbSNP: rs397514253
rs397514253
1.000 0.071 19 44908531 splice acceptor variant A/G snp
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.700 3 1982 1987
dbSNP: rs405509
rs405509
0.744 0.286 19 44905579 intergenic variant T/G snp 0.58
Low density lipoprotein cholesterol measurement
0.700 3 2012 2013
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
Apolipoprotein E, Deficiency or Defect of
0.700 3 1994 2004
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
Dysbetalipoproteinemia due to Defect in Apolipoprotein E-d
0.700 3 1994 2004
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
Familial Hyperbeta- and Prebetalipoproteinemia
0.700 3 1994 2004
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C1862562
Disease: Floating-Betalipoproteinemia
Floating-Betalipoproteinemia
0.700 3 1994 2004
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CORONARY ARTERY DISEASE, SEVERE, SUSCEPTIBILITY TO
0.700 3 1994 2004
dbSNP: rs7412
rs7412
0.642 0.357 19 44908822 missense variant C/T snp 6.2E-02 8.3E-02
CUI: C0020479
Disease: Hyperlipoproteinemia Type III
Hyperlipoproteinemia Type III
0.700 3 1994 2004