Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
GA | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
CATGTCGATAGATACAGCACATGTCGATA | 0.700 | CausalMutation | CLINVAR | Progressive hereditary spastic paraplegia caused by a homozygous KY mutation. | 28488683 | 2017 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | Diversity of ARSACS mutations in French-Canadians. | 23250129 | 2013 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | CYP7B1: novel mutations and magnetic resonance spectroscopy abnormalities in hereditary spastic paraplegia type 5A. | 24117163 | 2014 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Targeted next generation sequencing in SPAST-negative hereditary spastic paraplegia. | 23812641 | 2013 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Comparative modeling of 25-hydroxycholesterol-7α-hydroxylase (CYP7B1): ligand binding and analysis of hereditary spastic paraplegia type 5 CYP7B1 mutations. | 21541746 | 2012 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Amplicon-based high-throughput pooled sequencing identifies mutations in CYP7B1 and SPG7 in sporadic spastic paraplegia patients. | 21623769 | 2011 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | CYP7B1 mutations in pure and complex forms of hereditary spastic paraplegia type 5. | 19439420 | 2009 |
|||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Autosomal recessive spastic ataxia of Charlevoix-Saguenay: compound heterozygotes for nonsense mutations of the SACS gene. | 21745802 | 2011 |
|||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | Novel mutations in the sacsin gene in ataxia patients from Maritime Canada. | 19892370 | 2010 |