Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
0.800 | GeneticVariation | UNIPROT | Acute myeloblastic leukaemias in adult patients: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. | 23970018 | 2013 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | NCCN Task Force report: Evaluating the clinical utility of tumor markers in oncology. | 22138009 | 2011 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Mutation of CEBPA in familial acute myeloid leukemia. | 15575056 | 2004 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Mutations of CEBPA in acute myeloid leukemia FAB types M1 and M2. | 12661007 | 2003 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. | 11242107 | 2001 |
||||||||
|
|
A | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
CG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
TGTAG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
TCA | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
AG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
AGCTGTTCCACCCGCTTGCGCAGGCGGTCATTGTCACTGGTCAGCTCCAGCACCTTCT | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
TCAGCTCCAGCACCTTCTGCTGCGTCTC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
CG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
GCGGC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
0.010 | GeneticVariation | BEFREE | We identified five IDH1 mutations that were novel to AML: (1) c.299 G>A, p.R100Q; (2) c.311G>T, p.G104V; (3) c.322T>C, p.F108L; (4) c.356G>A, p.R119Q; and (5) c.388A>G, p.I130V. | 24376688 | 2013 |
||||||||
|
|
0.010 | GeneticVariation | BEFREE | We identified five IDH1 mutations that were novel to AML: (1) c.299 G>A, p.R100Q; (2) c.311G>T, p.G104V; (3) c.322T>C, p.F108L; (4) c.356G>A, p.R119Q; and (5) c.388A>G, p.I130V. | 24376688 | 2013 |