Gene Score gda Association Type Type Original DB Sentence supporting the association PMID PMID Year
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Beta thalassemias (βth) are the result of mutations in the β-globin gene. 30716678 2019
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 Biomarker disease BEFREE β-Thalassemia (BT) is a hereditary disorder characterized by altered hemoglobin beta-chain synthesis amenable to allogeneic HSC transplantation and HSC gene therapy. 30830876 2019
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Mutations of the beta-globin gene (HBB) cause beta-thalassaemia and sickle cell anaemia. 29853423 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE A Universal Approach to Correct Various HBB Gene Mutations in Human Stem Cells for Gene Therapy of Beta-Thalassemia and Sickle Cell Disease. 29164808 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Beta-thalassemia (β-thalassemia) minor is characterized by a mutation in one of the two β-globin genes (HBB) that produce the β-globin chains in the hemoglobin molecule. 30395680 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. 29619482 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. 29482624 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. 29295702 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Genotype-phenotype Correlation of β-Thalassemia in Croatian Patients: A Specific HBB Gene Mutations. 29240028 2018
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease CLINVAR Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study. 28643346 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. 28603845 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran. 26948378 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB -28 (A>G) homozygous mutation. 28942539 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR Prevalence and genetic analysis of α- and β-thalassemia in Baise region, a multi-ethnic region in southern China. 26877226 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 Biomarker disease BEFREE Haplotypes inside the beta-globin gene: use as new biomarkers for beta-thalassemia prenatal diagnosis in north of Iran. 29202846 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR Molecular Characterization of β-Thalassemia Mutations in Central Vietnam. 28671035 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Cooley anemia (CA), or β-thalassemia major, is the most severe form of the disease and occurs when an individual has mutations in both copies of the adult β-globin gene. 29296892 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 Biomarker disease BEFREE HBB mutations can be roughly divided into two categories: those that cause a dysfunctional protein (such as sickle cell disease but also including varied diseases caused by high-affinity hemoglobins, low-affinity hemoglobins, and methemoglobinemia) and those that cause the insufficient production of HBB protein (β-thalassemia). 29127682 2017
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE The β-haemoglobinopathies, such as sickle cell disease and β-thalassaemia, are caused by mutations in the β-globin (HBB) gene and affect millions of people worldwide. 27820943 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran. 27117567 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR). 27756326 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. 27525524 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. 26612711 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 GeneticVariation disease BEFREE Beta thalassemias (βth) are due to mutations in the β-globin gene. 27235732 2016
Entrez Id: 3043
Gene Symbol: HBB
HBB
0.800 CausalMutation disease CLINVAR Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East. 27453201 2016