Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104894401
rs104894401
3 0.878 0.107 13 20189154 missense variant C/T snp 0.800 13 1993 2016
dbSNP: rs104894402
rs104894402
4 0.878 0.179 13 20189359 missense variant G/A snp 0.800 5 1993 2003
dbSNP: rs104894407
rs104894407
3 0.923 0.107 13 20189450 stop gained C/G,T snp 2.8E-05 3.2E-05 0.800 4 1993 2011
dbSNP: rs104894413
rs104894413
9 0.784 0.214 13 20189451 stop gained C/G,T snp 2.4E-05 0.800 3 1993 2015
dbSNP: rs80338950
rs80338950
6 0.821 0.179 13 20189031 missense variant C/G,T snp 6.0E-05 6.4E-05 0.800 3 1993 2010
dbSNP: rs104894406
rs104894406
2 0.923 0.179 13 20188977 missense variant C/A snp 0.800 2 1993 2000
dbSNP: rs28931595
rs28931595
2 0.923 0.179 13 20189047 missense variant C/A,T snp 4.0E-06 0.800 2 1993 2004
dbSNP: rs1801002
rs1801002
5 0.846 0.286 13 20189547 missense variant C/A,T snp 9.2E-05; 7.2E-05 0.700 13 2000 2016
dbSNP: rs76434661
rs76434661
8 0.784 0.214 13 20189166 missense variant C/T snp 2.9E-04 4.8E-04 0.700 12 2001 2016
dbSNP: rs111033190
rs111033190
4 0.846 0.107 13 20189487 missense variant C/A,T snp 3.2E-05; 4.0E-06 0.700 11 2001 2015
dbSNP: rs111033295
rs111033295
3 0.923 0.107 13 20189217 missense variant T/A,G snp 6.0E-05 0.700 11 2002 2016
dbSNP: rs80338939
rs80338939
13 0.744 0.214 13 20189547 frameshift variant AC/A in-del 0.700 8 1997 2014
dbSNP: rs786204597
rs786204597
2 0.923 0.107 13 20188984 stop gained C/A,T snp 1.6E-05 0.700 6 2009 2015
dbSNP: rs1057517519
rs1057517519
2 0.923 0.107 13 20189523 missense variant A/G snp 0.700 5 2001 2015
dbSNP: rs779018464
rs779018464
4 0.846 0.107 13 20189193 missense variant C/G,T snp 4.0E-06 0.700 5 2003 2013
dbSNP: rs104894409
rs104894409
7 0.801 0.107 13 20189332 missense variant C/A,G,T snp 1.6E-05; 3.6E-05; 4.0E-06 0.700 4 2007 2015
dbSNP: rs28931593
rs28931593
7 0.801 0.179 13 20189358 missense variant C/T snp 0.700 4 1993 2005
dbSNP: rs80338943
rs80338943
6 0.821 0.179 13 20189347 frameshift variant AG/A in-del 4.0E-06; 4.7E-04 5.1E-04 0.700 4 1999 2015
dbSNP: rs587783647
rs587783647
3 0.923 0.107 13 20188932 frameshift variant ATATC/A in-del 8.0E-06; 4.8E-05 0.700 3 2001 2015
dbSNP: rs767178508
rs767178508
2 0.923 0.107 13 20189143 missense variant C/T snp 1.2E-05 0.700 3 2004 2010
dbSNP: rs1064797090
rs1064797090
1 1.000 0.107 13 20189410 missense variant G/C snp 0.700 2 1993 2015
dbSNP: rs111033294
rs111033294
8 0.784 0.214 13 20188965 missense variant T/C snp 9.6E-05 1.6E-04 0.700 2 2014 2015
dbSNP: rs199883710
rs199883710
2 0.923 0.107 13 20189344 stop gained G/A snp 8.0E-06 6.4E-05 0.700 2 2007 2007
dbSNP: rs371086981
rs371086981
2 0.923 0.107 13 20189580 start lost A/G snp 4.0E-06 0.700 2 2002 2011
dbSNP: rs397516873
rs397516873
2 0.923 0.107 13 20189514 frameshift variant GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC/G in-del 8.0E-06; 2.0E-05 0.700 2 2006 2011