MIR3606, microRNA 3606, 100500837

N. diseases: 1; N. variants: 42
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587779489
rs587779489 		1.000 0.160 2 188994577 missense variant G/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 32 1989 2017
dbSNP: rs587779584
rs587779584 		1.000 0.160 2 188996134 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 32 1989 2017
dbSNP: rs121912928
rs121912928 		1.000 0.160 2 188996171 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 26 1989 2017
dbSNP: rs587779476
rs587779476 		1.000 0.160 2 188995056 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 26 1989 2017
dbSNP: rs587779523
rs587779523 		1.000 0.160 2 188995091 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 26 1989 2017
dbSNP: rs587779637
rs587779637 		1.000 0.160 2 188994288 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 26 1989 2017
dbSNP: rs587779679
rs587779679 		1.000 0.160 2 188996162 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.800 1.000 26 1989 2017
dbSNP: rs1559056621
rs1559056621 		1.000 0.160 2 188995092 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 6 1993 2015
dbSNP: rs587779692
rs587779692 		0.925 0.240 2 188994297 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 6 1993 2015
dbSNP: rs1060500194
rs1060500194 		1.000 0.160 2 188994235 missense variant G/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 5 1993 2015
dbSNP: rs397509370
rs397509370 		1.000 0.160 2 188994595 splice donor variant G/A;T snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 4 1990 2016
dbSNP: rs1553507863
rs1553507863 		1.000 0.160 2 188994061 frameshift variant T/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 1 2017 2017
dbSNP: rs587779702
rs587779702 		1.000 0.160 2 188996124 splice region variant G/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 1.000 1 2014 2014
dbSNP: rs1057524653
rs1057524653 		1.000 0.160 2 188995074 missense variant G/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500199
rs1060500199 		1.000 0.160 2 188996167 frameshift variant C/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500204
rs1060500204 		1.000 0.160 2 188994540 splice acceptor variant G/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553507867
rs1553507867 		0.925 0.040 2 188994066 missense variant G/A snv
CUI: C0002940
Disease: Aneurysm
Aneurysm 		Cardiovascular Diseases 0.700 0
dbSNP: rs1553507867
rs1553507867 		0.925 0.040 2 188994066 missense variant G/A snv
CUI: C4707243
Disease: Familial thoracic aortic aneurysm and aortic dissection
Familial thoracic aortic aneurysm and aortic dissection 		0.700 0
dbSNP: rs1553508025
rs1553508025 		1.000 0.160 2 188995033 splice acceptor variant TCATTATTTTCAGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCC/- del
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1553508039
rs1553508039 		1.000 0.160 2 188995101 splice donor variant T/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559056438
rs1559056438 		0.925 0.200 2 188994727 missense variant G/A snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1559056438
rs1559056438 		0.925 0.200 2 188994727 missense variant G/A snv
CUI: C0347646
Disease: Perforation of colon
Perforation of colon 		Digestive System Diseases 0.700 0
dbSNP: rs587779430
rs587779430 		1.000 0.160 2 188994075 splice donor variant GAAATGGTAAGCTGTCCCCACTCCTCAGC/- delins
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs587779453
rs587779453 		1.000 0.160 2 188994597 splice region variant A/C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs587779459
rs587779459 		1.000 0.160 2 188994083 splice donor variant G/A;C snv
CUI: C0268338
Disease: Ehlers-Danlos Syndrome, Type IV
Ehlers-Danlos Syndrome, Type IV 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Skin and Connective Tissue Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0