Disease: Congenital Thrombotic Thrombocytopenic Purpura ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs387906342
rs387906342 		1.000 0.080 9 133443515 frameshift variant AGCTGTGGCGCTGGAAACCTGCAACC/- delins
CUI: C1268935
Disease: Congenital Thrombotic Thrombocytopenic Purpura
Congenital Thrombotic Thrombocytopenic Purpura 		Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases 0.700 0