KCNQ1-AS1, KCNQ1 antisense RNA 1, 338653

N. diseases: 6; N. variants: 14
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs199472821
rs199472821 		1.000 0.120 11 2847848 missense variant G/A snv 1.1E-05 1.4E-05
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 1.000 20 1996 2015
dbSNP: rs147445322
rs147445322 		0.882 0.120 11 2847803 missense variant G/A;T snv 7.2E-05; 5.5E-06
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 1.000 4 2011 2017
dbSNP: rs199472819
rs199472819 		1.000 0.120 11 2847827 missense variant T/A snv
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 20 1996 2015
dbSNP: rs199473484
rs199473484 		1.000 0.120 11 2847875 missense variant G/A snv 1.6E-05 4.9E-05
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 20 1996 2015
dbSNP: rs34516117
rs34516117 		1.000 0.120 11 2847771 missense variant C/T snv 1.6E-04 6.1E-04
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 20 1996 2015
dbSNP: rs397508104
rs397508104 		0.925 0.120 11 2847859 frameshift variant C/-;CC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 6 1999 2014
dbSNP: rs147445322
rs147445322 		0.882 0.120 11 2847803 missense variant G/A;T snv 7.2E-05; 5.5E-06
CUI: C0740394
Disease: Hyperuricemia
Hyperuricemia 		Pathological Conditions, Signs and Symptoms 0.700 1.000 1 2018 2018
dbSNP: rs147445322
rs147445322 		0.882 0.120 11 2847803 missense variant G/A;T snv 7.2E-05; 5.5E-06
CUI: C0202239
Disease: Uric acid measurement (procedure)
Uric acid measurement (procedure) 		0.700 1.000 1 2018 2018
dbSNP: rs1464992494
rs1464992494 		1.000 0.120 11 2847874 frameshift variant -/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs397508101
rs397508101 		11 2847812 inframe deletion CCA/- delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs397508103
rs397508103 		1.000 0.080 11 2847863 frameshift variant CCAGAGAGGGCGGGGCCCAC/- delins
CUI: C4551509
Disease: Jervell And Lange-Nielsen Syndrome 1
Jervell And Lange-Nielsen Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs397508104
rs397508104 		0.925 0.120 11 2847859 frameshift variant C/-;CC delins
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs397508105
rs397508105 		1.000 0.120 11 2847865 frameshift variant -/A delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1800172
rs1800172 		0.925 0.120 11 2847899 missense variant G/A;T snv 6.2E-03
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.020 1.000 2 2014 2018
dbSNP: rs10798
rs10798 		11 2848935 3 prime UTR variant A/G snv 0.44 0.38
CUI: C0741923
Disease: cardiac event
cardiac event 		0.010 1.000 1 2016 2016
dbSNP: rs147445322
rs147445322 		0.882 0.120 11 2847803 missense variant G/A;T snv 7.2E-05; 5.5E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2005 2005
dbSNP: rs1800172
rs1800172 		0.925 0.120 11 2847899 missense variant G/A;T snv 6.2E-03
CUI: C0079035
Disease: Bradyarrhythmia (disorder)
Bradyarrhythmia (disorder) 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.010 1.000 1 2001 2001
dbSNP: rs1800172
rs1800172 		0.925 0.120 11 2847899 missense variant G/A;T snv 6.2E-03
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2006 2006
dbSNP: rs1800172
rs1800172 		0.925 0.120 11 2847899 missense variant G/A;T snv 6.2E-03
CUI: C1560249
Disease: Adverse Event Associated with Cardiac Arrhythmia
Adverse Event Associated with Cardiac Arrhythmia 		0.010 1.000 1 2018 2018
dbSNP: rs201698592
rs201698592 		0.925 0.080 11 2847916 synonymous variant C/T snv 1.7E-04 2.8E-05
CUI: C0085612
Disease: Ventricular arrhythmia
Ventricular arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.010 1.000 1 2020 2020
dbSNP: rs201698592
rs201698592 		0.925 0.080 11 2847916 synonymous variant C/T snv 1.7E-04 2.8E-05
CUI: C0155626
Disease: Acute myocardial infarction
Acute myocardial infarction 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.010 1.000 1 2020 2020
dbSNP: rs8234
rs8234 		11 2848878 3 prime UTR variant A/G snv 0.45 0.38
CUI: C0741923
Disease: cardiac event
cardiac event 		0.010 1.000 1 2016 2016