JAK3, Janus kinase 3, 3718

N. diseases: 194; N. variants: 28
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121913504
rs121913504 		0.882 0.080 19 17837200 missense variant G/A snv
CUI: C0023462
Disease: Acute Megakaryocytic Leukemias
Acute Megakaryocytic Leukemias 		Neoplasms 0.710 1.000 1 2006 2006
dbSNP: rs137852624
rs137852624 		0.882 0.120 19 17843786 missense variant T/C snv 4.0E-06
CUI: C1833275
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 1.000 5 1995 2004
dbSNP: rs147181709
rs147181709 		1.000 0.120 19 17843086 missense variant G/T snv 4.1E-06
CUI: C1833275
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 1.000 5 1995 2004
dbSNP: rs55778349
rs55778349 		1.000 0.120 19 17843141 missense variant G/C snv 5.9E-03 6.4E-03
CUI: C1833275
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 1.000 5 1995 2004
dbSNP: rs121913504
rs121913504 		0.882 0.080 19 17837200 missense variant G/A snv
CUI: C1292778
Disease: Chronic myeloproliferative disorder
Chronic myeloproliferative disorder 		Neoplasms; Hemic and Lymphatic Diseases 0.700 1.000 4 2010 2014
dbSNP: rs1057519770
rs1057519770 		0.882 0.160 19 17843825 missense variant A/G snv
CUI: C0023462
Disease: Acute Megakaryocytic Leukemias
Acute Megakaryocytic Leukemias 		Neoplasms 0.700 1.000 1 2008 2008
dbSNP: rs1057519770
rs1057519770 		0.882 0.160 19 17843825 missense variant A/G snv
CUI: C0023501
Disease: Leukemoid Reaction
Leukemoid Reaction 		Hemic and Lymphatic Diseases 0.700 1.000 1 2008 2008
dbSNP: rs1057520020
rs1057520020 		1.000 0.120 19 17834908 missense variant C/T snv
CUI: C0085110
Disease: Severe Combined Immunodeficiency
Severe Combined Immunodeficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 1.000 1 2008 2008
dbSNP: rs201283129
rs201283129 		0.882 0.160 19 17838329 missense variant C/A;G snv 2.0E-05
CUI: C0023462
Disease: Acute Megakaryocytic Leukemias
Acute Megakaryocytic Leukemias 		Neoplasms 0.700 1.000 1 2008 2008
dbSNP: rs201283129
rs201283129 		0.882 0.160 19 17838329 missense variant C/A;G snv 2.0E-05
CUI: C0023501
Disease: Leukemoid Reaction
Leukemoid Reaction 		Hemic and Lymphatic Diseases 0.700 1.000 1 2008 2008
dbSNP: rs3212756
rs3212756 		19 17837038 non coding transcript exon variant G/T snv 9.1E-03 4.8E-02
CUI: C0202236
Disease: Triglycerides measurement
Triglycerides measurement 		0.700 1.000 1 2012 2012
dbSNP: rs3212799
rs3212799 		19 17826707 3 prime UTR variant C/T snv 1.0E-02 2.0E-02
CUI: C0202236
Disease: Triglycerides measurement
Triglycerides measurement 		0.700 1.000 1 2012 2012
dbSNP: rs758959409
rs758959409 		0.882 0.160 19 17835160 missense variant C/A;T snv 4.0E-06
CUI: C0023501
Disease: Leukemoid Reaction
Leukemoid Reaction 		Hemic and Lymphatic Diseases 0.700 1.000 1 2008 2008
dbSNP: rs758959409
rs758959409 		0.882 0.160 19 17835160 missense variant C/A;T snv 4.0E-06
CUI: C0023462
Disease: Acute Megakaryocytic Leukemias
Acute Megakaryocytic Leukemias 		Neoplasms 0.700 1.000 1 2008 2008
dbSNP: rs137852624
rs137852624 		0.882 0.120 19 17843786 missense variant T/C snv 4.0E-06
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs137852625
rs137852625 		1.000 0.120 19 17837938 stop gained G/T snv 4.0E-06 7.0E-06
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs137852626
rs137852626 		1.000 0.120 19 17839585 stop gained G/A snv
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs137852627
rs137852627 		1.000 0.120 19 17844244 inframe deletion GGC/- del
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs1555743321
rs1555743321 		1.000 0.120 19 17831775 frameshift variant TGACCAGCCGCAGGCTCTGGCG/- del
CUI: C0085110
Disease: Severe Combined Immunodeficiency
Severe Combined Immunodeficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs1568400897
rs1568400897 		1.000 0.120 19 17830610 stop gained C/A snv
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs1568404443
rs1568404443 		1.000 0.120 19 17838268 stop gained CCAG/GTCA mnv
CUI: C1832322
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Negative, NK Cell-Positive 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs193922361
rs193922361 		0.925 0.120 19 17837171 missense variant G/A snv
CUI: C1833275
Disease: Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative
Severe Combined Immunodeficiency, Autosomal Recessive, T Cell-Negative, B Cell-Positive, NK Cell-Negative 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs193922361
rs193922361 		0.925 0.120 19 17837171 missense variant G/A snv
CUI: C0085110
Disease: Severe Combined Immunodeficiency
Severe Combined Immunodeficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs193922362
rs193922362 		1.000 0.120 19 17837148 synonymous variant G/A snv 5.8E-06
CUI: C0085110
Disease: Severe Combined Immunodeficiency
Severe Combined Immunodeficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs193922364
rs193922364 		1.000 0.120 19 17842498 frameshift variant AG/- del 4.7E-06
CUI: C0085110
Disease: Severe Combined Immunodeficiency
Severe Combined Immunodeficiency 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0