Disease: Long QT Syndrome ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs199472712
rs199472712 		0.882 0.120 11 2572053 missense variant G/A;T snv 4.0E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 1998 2015
dbSNP: rs199473451
rs199473451 		0.925 0.120 11 2527971 missense variant A/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2003 2007
dbSNP: rs397508075
rs397508075 		1.000 0.120 11 2585254 stop gained C/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2009 2013
dbSNP: rs397508087
rs397508087 		1.000 0.120 11 2588799 frameshift variant C/-;CC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2003 2016
dbSNP: rs397508133
rs397508133 		1.000 0.120 11 2583433 splice acceptor variant A/C;G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 1997 2016
dbSNP: rs794728568
rs794728568 		0.925 0.120 11 2570707 missense variant G/A;T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 3 2012 2016
dbSNP: rs1564820372
rs1564820372 		1.000 0.120 11 2571324 splice acceptor variant G/C snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1997 2009
dbSNP: rs1564820729
rs1564820729 		1.000 0.120 11 2572011 splice acceptor variant A/C snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1997 2009
dbSNP: rs199472807
rs199472807 		0.925 0.120 11 2777002 missense variant G/A;C snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 2003 2016
dbSNP: rs397508096
rs397508096 		1.000 0.120 11 2445251 stop gained C/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 2005 2009
dbSNP: rs397508111
rs397508111 		0.882 0.120 11 2528023 splice region variant G/A;C snv 1.2E-05
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1999 2013
dbSNP: rs397508117
rs397508117 		0.925 0.120 11 2570712 frameshift variant -/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 1997 2011
dbSNP: rs397508120
rs397508120 		0.882 0.120 11 2570734 frameshift variant G/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 2002 2009
dbSNP: rs120074186
rs120074186 		0.851 0.120 11 2572979 stop gained G/A;C;T snv 1.6E-05; 4.0E-06; 4.0E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 1 2003 2003
dbSNP: rs763462603
rs763462603 		0.925 0.120 11 2570665 frameshift variant TCTGGTCCGCC/-;TCTGGTCCGCCTCTGGTCCGCC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 1 2009 2009
dbSNP: rs1060500623
rs1060500623 		1.000 0.120 11 2445295 frameshift variant C/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500626
rs1060500626 		1.000 0.120 11 2572069 frameshift variant AGGCTCCTGG/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500628
rs1060500628 		1.000 0.120 11 2572062 stop gained G/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1060500629
rs1060500629 		1.000 0.120 11 2587616 stop gained G/A snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs12720458
rs12720458 		0.716 0.240 11 2585264 missense variant A/G snv 4.0E-05 1.4E-05
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1435990592
rs1435990592 		1.000 0.120 11 2445295 frameshift variant CGGCCGCGCCC/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1464992494
rs1464992494 		1.000 0.120 11 2847874 frameshift variant -/G delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554893228
rs1554893228 		1.000 0.120 11 2572899 stop gained C/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554958043
rs1554958043 		1.000 0.120 11 2445192 stop gained A/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554958132
rs1554958132 		1.000 0.120 11 2445478 frameshift variant -/GC delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0