SHISA5, shisa family member 5, 51246

N. diseases: 2; N. variants: 14
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs370504038
rs370504038 		0.851 0.160 3 48467569 missense variant A/G snv 1.2E-04 1.2E-04
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.710 1.000 4 2007 2013
dbSNP: rs76224909
rs76224909 		1.000 0.120 3 48467562 missense variant A/C snv 2.0E-05 7.0E-06
CUI: C0796126
Disease: AICARDI-GOUTIERES SYNDROME 1
AICARDI-GOUTIERES SYNDROME 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Nervous System Diseases 0.700 1.000 8 2006 2013
dbSNP: rs79318303
rs79318303 		0.882 0.320 3 48467514 inframe deletion CCACTGGGTCTGCTGGCC/- delins
CUI: C0024145
Disease: Chilblain lupus 1
Chilblain lupus 1 		Skin and Connective Tissue Diseases; Wounds and Injuries 0.700 1.000 4 2010 2017
dbSNP: rs79318303
rs79318303 		0.882 0.320 3 48467514 inframe deletion CCACTGGGTCTGCTGGCC/- delins
CUI: C1860518
Disease: Vasculopathy, Retinal, With Cerebral Leukodystrophy
Vasculopathy, Retinal, With Cerebral Leukodystrophy 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Eye Diseases; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 4 2010 2017
dbSNP: rs79318303
rs79318303 		0.882 0.320 3 48467514 inframe deletion CCACTGGGTCTGCTGGCC/- delins
CUI: C0796126
Disease: AICARDI-GOUTIERES SYNDROME 1
AICARDI-GOUTIERES SYNDROME 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Nervous System Diseases 0.700 1.000 4 2010 2017
dbSNP: rs148833270
rs148833270 		1.000 0.080 3 48467524 missense variant C/T snv 6.4E-05 2.1E-05
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.700 1.000 3 2007 2013
dbSNP: rs72556555
rs72556555 		1.000 0.080 3 48467375 missense variant G/A;C snv 2.0E-05; 2.0E-04
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.700 1.000 3 2007 2013
dbSNP: rs1553820518
rs1553820518 		0.882 0.320 3 48467484 stop gained A/T snv
CUI: C0024145
Disease: Chilblain lupus 1
Chilblain lupus 1 		Skin and Connective Tissue Diseases; Wounds and Injuries 0.700 1.000 2 2007 2016
dbSNP: rs1553820518
rs1553820518 		0.882 0.320 3 48467484 stop gained A/T snv
CUI: C0796126
Disease: AICARDI-GOUTIERES SYNDROME 1
AICARDI-GOUTIERES SYNDROME 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Nervous System Diseases 0.700 1.000 2 2007 2016
dbSNP: rs1553820518
rs1553820518 		0.882 0.320 3 48467484 stop gained A/T snv
CUI: C1860518
Disease: Vasculopathy, Retinal, With Cerebral Leukodystrophy
Vasculopathy, Retinal, With Cerebral Leukodystrophy 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Eye Diseases; Nervous System Diseases; Cardiovascular Diseases 0.700 1.000 2 2007 2016
dbSNP: rs114582462
rs114582462 		3 48475940 intron variant A/G snv 1.3E-02
CUI: C0427460
Disease: Red cell distribution width determination
Red cell distribution width determination 		0.700 1.000 1 2019 2019
dbSNP: rs114582462
rs114582462 		3 48475940 intron variant A/G snv 1.3E-02
CUI: C1304746
Disease: RDW - Red blood cell distribution width result
RDW - Red blood cell distribution width result 		0.700 1.000 1 2019 2019
dbSNP: rs112741962
rs112741962 		1.000 0.080 3 48467394 missense variant G/C snv 1.2E-04 4.6E-04
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.700 0
dbSNP: rs113107733
rs113107733 		1.000 0.080 3 48467334 missense variant G/A snv 1.3E-04 5.0E-04
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.700 0
dbSNP: rs1553820434
rs1553820434 		0.882 0.320 3 48467354 frameshift variant -/G delins
CUI: C0024145
Disease: Chilblain lupus 1
Chilblain lupus 1 		Skin and Connective Tissue Diseases; Wounds and Injuries 0.700 0
dbSNP: rs1553820434
rs1553820434 		0.882 0.320 3 48467354 frameshift variant -/G delins
CUI: C0796126
Disease: AICARDI-GOUTIERES SYNDROME 1
AICARDI-GOUTIERES SYNDROME 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1553820434
rs1553820434 		0.882 0.320 3 48467354 frameshift variant -/G delins
CUI: C1860518
Disease: Vasculopathy, Retinal, With Cerebral Leukodystrophy
Vasculopathy, Retinal, With Cerebral Leukodystrophy 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Eye Diseases; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs1560113283
rs1560113283 		1.000 0.200 3 48467357 frameshift variant -/GTCA delins
CUI: C1860518
Disease: Vasculopathy, Retinal, With Cerebral Leukodystrophy
Vasculopathy, Retinal, With Cerebral Leukodystrophy 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Eye Diseases; Nervous System Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs780022923
rs780022923 		1.000 0.080 3 48467572 missense variant G/A;C snv 4.0E-06
CUI: C0024141
Disease: Lupus Erythematosus, Systemic
Lupus Erythematosus, Systemic 		Skin and Connective Tissue Diseases; Immune System Diseases 0.700 0
dbSNP: rs78379807
rs78379807 		1.000 0.120 3 48467261 inframe insertion -/CCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC delins
CUI: C0796126
Disease: AICARDI-GOUTIERES SYNDROME 1
AICARDI-GOUTIERES SYNDROME 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Nervous System Diseases 0.700 0
dbSNP: rs3135945
rs3135945 		1.000 0.200 3 48467567 synonymous variant G/A snv 9.4E-03 4.0E-02
CUI: C0019693
Disease: HIV Infections
HIV Infections 		Infections; Immune System Diseases 0.010 1.000 1 2013 2013
dbSNP: rs3135945
rs3135945 		1.000 0.200 3 48467567 synonymous variant G/A snv 9.4E-03 4.0E-02
CUI: C0151449
Disease: Primary Sjögren's syndrome
Primary Sjögren's syndrome 		Eye Diseases; Skin and Connective Tissue Diseases; Musculoskeletal Diseases; Immune System Diseases; Stomatognathic Diseases 0.010 1.000 1 2019 2019
dbSNP: rs370504038
rs370504038 		0.851 0.160 3 48467569 missense variant A/G snv 1.2E-04 1.2E-04
CUI: C0024131
Disease: Lupus Vulgaris
Lupus Vulgaris 		Infections; Skin and Connective Tissue Diseases 0.010 1.000 1 2011 2011
dbSNP: rs370504038
rs370504038 		0.851 0.160 3 48467569 missense variant A/G snv 1.2E-04 1.2E-04
CUI: C0409974
Disease: Lupus Erythematosus
Lupus Erythematosus 		Pathological Conditions, Signs and Symptoms; Skin and Connective Tissue Diseases; Immune System Diseases 0.010 1.000 1 2011 2011
dbSNP: rs370504038
rs370504038 		0.851 0.160 3 48467569 missense variant A/G snv 1.2E-04 1.2E-04
CUI: C0024138
Disease: Lupus Erythematosus, Discoid
Lupus Erythematosus, Discoid 		Skin and Connective Tissue Diseases 0.010 1.000 1 2011 2011