Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1564673999
rs1564673999 		1.000 0.120 10 86756638 splice donor variant CGGCCGCTGCAGAGATTGGAATCCGCCTGCCGGGCTTGGCGAAGGAGAAGGGAGGAGGCAGGAGCGAGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCGGCGCGTCCGTCCGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCGGG/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2010 2012
dbSNP: rs11202222
rs11202222 		1.000 0.080 10 86842729 intron variant C/G snv 0.18
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs10788528
rs10788528 		1.000 0.080 10 86857014 intron variant G/A snv 0.14
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs786203157
rs786203157 		1.000 0.120 10 86876019 start lost A/C;G snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2009 2013
dbSNP: rs786203157
rs786203157 		1.000 0.120 10 86876019 start lost A/C;G snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs869312758
rs869312758 		10 86876021 start lost G/C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1392086533
rs1392086533 		10 86876033 stop gained C/A;T snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1554886816
rs1554886816 		1.000 0.120 10 86876060 frameshift variant TGTT/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2013
dbSNP: rs1131691171
rs1131691171 		10 86876085 missense variant G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs7922846
rs7922846 		1.000 0.080 10 86881744 intron variant A/G;T snv
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs1131691174
rs1131691174 		10 86890061 splice acceptor variant G/A;C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587783038
rs587783038 		1.000 0.120 10 86890109 frameshift variant -/A ins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 7 2001 2013
dbSNP: rs1564714804
rs1564714804 		1.000 0.120 10 86890126 frameshift variant GA/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs1564714809
rs1564714809 		1.000 0.120 10 86890133 stop gained G/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs1131691183
rs1131691183 		10 86890153 frameshift variant G/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1057517610
rs1057517610 		10 86890164 missense variant C/G snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2004 2013
dbSNP: rs786201038
rs786201038 		1.000 0.120 10 86890165 frameshift variant T/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2013 2013
dbSNP: rs786201038
rs786201038 		1.000 0.120 10 86890165 frameshift variant T/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 1 2013 2013
dbSNP: rs1564714834
rs1564714834 		1.000 0.120 10 86890170 stop gained T/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs1413243663
rs1413243663 		10 86890183 stop gained C/A;T snv 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1554888134
rs1554888134 		10 86890191 frameshift variant -/TGTCC delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1064792985
rs1064792985 		1.000 0.120 10 86890203 frameshift variant TATTAATAACACATGC/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs786201501
rs786201501 		10 86890208 frameshift variant -/T delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1564715427
rs1564715427 		1.000 0.120 10 86892126 splice acceptor variant G/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2002
dbSNP: rs786204187
rs786204187 		1.000 0.120 10 86892139 frameshift variant TTTGC/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0