Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs10788528
rs10788528 		1.000 0.080 10 86857014 intron variant G/A snv 0.14
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs11202222
rs11202222 		1.000 0.080 10 86842729 intron variant C/G snv 0.18
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs12765929
rs12765929 		10 86922798 intron variant G/A;T snv
CUI: C0027651
Disease: Neoplasms
Neoplasms 		Neoplasms 0.010 1.000 1 2010 2010
dbSNP: rs1329735599
rs1329735599 		1.000 0.080 10 86923504 missense variant G/A snv 4.0E-06
CUI: C1862151
Disease: BRACHYDACTYLY, TYPE A1 (disorder)
BRACHYDACTYLY, TYPE A1 (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.010 1.000 1 2013 2013
dbSNP: rs199476086
rs199476086 		0.925 0.120 10 86919316 missense variant C/A;T snv
CUI: C0018553
Disease: Hamartoma Syndrome, Multiple
Hamartoma Syndrome, Multiple 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.010 1.000 1 2001 2001
dbSNP: rs7922846
rs7922846 		1.000 0.080 10 86881744 intron variant A/G;T snv
CUI: C0028754
Disease: Obesity
Obesity 		Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases 0.010 1.000 1 2009 2009
dbSNP: rs587783038
rs587783038 		1.000 0.120 10 86890109 frameshift variant -/A ins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 7 2001 2013
dbSNP: rs199476087
rs199476087 		1.000 0.120 10 86899830 missense variant T/C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 1997 2013
dbSNP: rs1057517610
rs1057517610 		10 86890164 missense variant C/G snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2004 2013
dbSNP: rs1554888310
rs1554888310 		10 86892141 missense variant G/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2002 2013
dbSNP: rs199476089
rs199476089 		1.000 0.120 10 86923442 missense variant T/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 4 2001 2003
dbSNP: rs1564673999
rs1564673999 		1.000 0.120 10 86756638 splice donor variant CGGCCGCTGCAGAGATTGGAATCCGCCTGCCGGGCTTGGCGAAGGAGAAGGGAGGAGGCAGGAGCGAGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCGGCGCGTCCGTCCGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCGGG/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2010 2012
dbSNP: rs199476086
rs199476086 		0.925 0.120 10 86919316 missense variant C/A;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2001 2013
dbSNP: rs587782682
rs587782682 		1.000 0.120 10 86917140 stop gained C/A;T snv 3.2E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2002 2013
dbSNP: rs730881431
rs730881431 		10 86892158 stop gained G/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2002 2009
dbSNP: rs1060503408
rs1060503408 		1.000 0.120 10 86919236 frameshift variant C/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2002
dbSNP: rs1554886816
rs1554886816 		1.000 0.120 10 86876060 frameshift variant TGTT/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2013
dbSNP: rs1554891044
rs1554891044 		10 86919263 frameshift variant C/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2001 2004
dbSNP: rs1564715427
rs1564715427 		1.000 0.120 10 86892126 splice acceptor variant G/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2002
dbSNP: rs1564724111
rs1564724111 		1.000 0.120 10 86919170 splice acceptor variant AGGTT/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2002
dbSNP: rs587782400
rs587782400 		1.000 0.120 10 86917275 stop gained C/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2009
dbSNP: rs587782682
rs587782682 		1.000 0.120 10 86917140 stop gained C/A;T snv 3.2E-05
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2002 2013
dbSNP: rs764466442
rs764466442 		1.000 0.120 10 86919384 stop gained C/G;T snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 2001 2007
dbSNP: rs786203157
rs786203157 		1.000 0.120 10 86876019 start lost A/C;G snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2009 2013
dbSNP: rs112669180
rs112669180 		10 86930893 3 prime UTR variant T/C snv 4.3E-02
CUI: C0005890
Disease: Body Height
Body Height 		0.700 1.000 1 2019 2019