| Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
0.010 | GeneticVariation | BEFREE | The luciferase assays further showed that there was a point mutation (A231G) in the C/EBPα binding site of the lncRNA-UCA1 core promoter in various bladder cancer cell lines, which in turn significantly increased the transcriptional activity of lncRNA-UCA1. | 24648007 | 2014 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The luciferase assays further showed that there was a point mutation (A231G) in the C/EBPα binding site of the lncRNA-UCA1 core promoter in various bladder cancer cell lines, which in turn significantly increased the transcriptional activity of lncRNA-UCA1. | 24648007 | 2014 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The luciferase assays further showed that there was a point mutation (A231G) in the C/EBPα binding site of the lncRNA-UCA1 core promoter in various bladder cancer cell lines, which in turn significantly increased the transcriptional activity of lncRNA-UCA1. | 24648007 | 2014 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | Association between a genetic variation in C/EBPalpha (rs12691) and metabolic parameters was tested in the Swedish Obese Subjects (SOS) study (n = 528) and replicated in Finnish individuals from the Botnia type 2 diabetes study (n = 4,866). | 18765514 | 2008 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The presence of the A allele of rs12691 influences glucose metabolism of MetS patients. | 22269963 | 2013 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | We identified five IDH1 mutations that were novel to AML: (1) c.299 G>A, p.R100Q; (2) c.311G>T, p.G104V; (3) c.322T>C, p.F108L; (4) c.356G>A, p.R119Q; and (5) c.388A>G, p.I130V. | 24376688 | 2013 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | ATXN8 -62 G/A promoter polymorphism and risk of Taiwanese Parkinson's disease. | 22577844 | 2012 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | We identified five IDH1 mutations that were novel to AML: (1) c.299 G>A, p.R100Q; (2) c.311G>T, p.G104V; (3) c.322T>C, p.F108L; (4) c.356G>A, p.R119Q; and (5) c.388A>G, p.I130V. | 24376688 | 2013 | |||||||
|
|
|
A | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TGTAG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TCA | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AGCTGTTCCACCCGCTTGCGCAGGCGGTCATTGTCACTGGTCAGCTCCAGCACCTTCT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TCAGCTCCAGCACCTTCTGCTGCGTCTC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR |