| Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
0.800 | GeneticVariation | UNIPROT | Acute myeloblastic leukaemias in adult patients: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. | 23970018 | 2013 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | NCCN Task Force report: Evaluating the clinical utility of tumor markers in oncology. | 22138009 | 2011 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Mutation of CEBPA in familial acute myeloid leukemia. | 15575056 | 2004 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Mutations of CEBPA in acute myeloid leukemia FAB types M1 and M2. | 12661007 | 2003 | |||||||
|
|
|
0.800 | GeneticVariation | UNIPROT | Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. | 11242107 | 2001 | |||||||
|
|
|
A | 0.800 | CausalMutation | CLINVAR | |||||||||
|
|
|
G | 0.700 | GeneticVariation | GWASCAT | Maternal and fetal genetic effects on birth weight and their relevance to cardio-metabolic risk factors. | 31043758 | 2019 | ||||||
|
|
|
A | 0.700 | GeneticVariation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TGTAG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TCA | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
AGCTGTTCCACCCGCTTGCGCAGGCGGTCATTGTCACTGGTCAGCTCCAGCACCTTCT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
TCAGCTCCAGCACCTTCTGCTGCGTCTC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
C | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
CG | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GCGGC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The rs34529039 SNP did not affect the risk of developing ova</span>rian cancer. | 27602952 | 2016 | |||||||
|
|
|
0.010 | GeneticVariation | BEFREE | The luciferase assays further showed that there was a point mutation (A231G) in the C/EBPα binding site of the lncRNA-UCA1 core promoter in various bladder cancer cell lines, which in turn significantly increased the transcriptional activity of lncRNA-UCA1. | 24648007 | 2014 |