Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
A | 0.820 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.810 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
TC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
ACAGCAGCAGCAGCAGCAGCAACAGCAGCCG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
GC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
0.700 | GeneticVariation | UNIPROT | |||||||||||
|
|
0.700 | GeneticVariation | UNIPROT | |||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
0.820 | GeneticVariation | UNIPROT | Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. | 9207800 | 1997 |
||||||||
|
|
0.820 | GeneticVariation | UNIPROT | Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. | 9182765 | 1997 |
||||||||
|
|
0.810 | GeneticVariation | UNIPROT | Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. | 9182765 | 1997 |
||||||||
|
|
0.810 | GeneticVariation | BEFREE | Here, we describe two de novo missense mutations, Met175Arg and Ser191Asn, in the OSF2/CBFA1 gene in two patients with CCD. | 9207800 | 1997 |
||||||||
|
|
0.810 | GeneticVariation | UNIPROT | Here, we describe two de novo missense mutations, Met175Arg and Ser191Asn, in the OSF2/CBFA1 gene in two patients with CCD. | 9207800 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. | 9207800 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. | 9182765 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. | 9182765 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. | 9207800 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. | 9182765 | 1997 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. | 9207800 | 1997 |