Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
A | 0.820 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.810 | CausalMutation | CLINVAR | ||||||||||
|
|
C | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
G | 0.800 | CausalMutation | CLINVAR | ||||||||||
|
|
TC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
ACAGCAGCAGCAGCAGCAGCAACAGCAGCCG | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
GC | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
0.700 | GeneticVariation | UNIPROT | |||||||||||
|
|
0.700 | GeneticVariation | UNIPROT | |||||||||||
|
|
C | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||||||
|
|
0.820 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.810 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.700 | GeneticVariation | UNIPROT | A case of cleidocranial dysplasia with peculiar dental features: pathogenetic role of the RUNX2 mutation and long term follow-up. | 24984680 | 2014 |
||||||||
|
|
0.010 | GeneticVariation | BEFREE | A new phenotypic variant in cleidocranial dysplasia (CCD) associated with mutation c.391C>T of the RUNX2 gene. | 23220435 | 2012 |
||||||||
|
|
0.820 | GeneticVariation | UNIPROT | A novel CBFA1 mutation (R190W) in an Italian family with cleidocranial dysplasia. | 10980549 | 2000 |
||||||||
|
|
0.810 | GeneticVariation | UNIPROT | A novel CBFA1 mutation (R190W) in an Italian family with cleidocranial dysplasia. | 10980549 | 2000 |
||||||||
|
|
0.800 | GeneticVariation | UNIPROT | A novel CBFA1 mutation (R190W) in an Italian family with cleidocranial dysplasia. | 10980549 | 2000 |