Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs74799832
rs74799832
RET
24 0.685 0.250 10 43121968 missense variant T/C snp 4.0E-06 0.800 1.000 18 1996 2017
dbSNP: rs79658334
rs79658334
RET
19 0.685 0.321 10 43119548 missense variant G/A,C,T snp 1.2E-04; 4.3E-06 2.2E-04 0.770 0.857 8 1997 2011
dbSNP: rs75076352
rs75076352
RET
15 0.734 0.214 10 43114500 missense variant T/A,C,G snp 1.2E-05 0.760 1.000 8 1995 2015
dbSNP: rs75234356
rs75234356
RET
10 0.744 0.214 10 43120144 missense variant T/G snp 1.2E-05 0.750 0.800 6 1998 2016
dbSNP: rs377767404
rs377767404
RET
9 0.756 0.143 10 43114488 missense variant T/C snp 0.720 1.000 3 1999 2005
dbSNP: rs75996173
rs75996173
RET
16 0.734 0.214 10 43114501 missense variant G/A,C,T snp 4.0E-06; 4.0E-06 0.720 1.000 3 1996 2015
dbSNP: rs76262710
rs76262710
RET
10 0.756 0.143 10 43113648 stop lost T/A,C,G snp 4.0E-06; 4.0E-06 0.720 1.000 3 1997 2015
dbSNP: rs77939446
rs77939446
RET
12 0.734 0.107 10 43113622 missense variant G/A,C,T snp 4.0E-06 0.720 1.000 3 1995 2006
dbSNP: rs79781594
rs79781594
RET
10 0.756 0.143 10 43113649 stop lost G/A,C,T snp 0.720 1.000 3 1999 2015
dbSNP: rs77709286
rs77709286
RET
10 0.769 0.107 10 43114502 missense variant C/G snp 4.0E-06 0.710 1.000 4 2011 2015
dbSNP: rs377767429
rs377767429
RET
7 0.784 0.107 10 43120120 missense variant GC/TT multinucleotide-polymorphism 0.710 1.000 3 2004 2015
dbSNP: rs121913240
rs121913240
12 0.744 0.321 12 25227342 missense variant T/A,C,G snp 0.710 1.000 2 2014 2016
dbSNP: rs77503355
rs77503355
RET
8 0.769 0.143 10 43113655 missense variant G/A,C,T snp 0.710 1.000 2 1997 2015
dbSNP: rs121913309
rs121913309
RET
1 1.000 0.071 10 43120165 inframe deletion AGATGTTTATGAA/A in-del 0.700 1 2015 2015
dbSNP: rs121913312
rs121913312
RET
1 1.000 0.071 10 43114494 inframe deletion CGAGCTG/C in-del 0.700 1 2015 2015
dbSNP: rs121913313
rs121913313
RET
1 1.000 0.071 10 43113630 inframe deletion CTTCCCTGAGGAGGAGAAGTGCTTCTGC/C in-del 0.700 1 2015 2015
dbSNP: rs78014899
rs78014899
RET
7 0.801 0.107 10 43118392 missense variant G/A,C,T snp 8.0E-06 0.700 1 1997 1997
dbSNP: rs1799939
rs1799939
RET
18 0.685 0.250 10 43114671 missense variant G/A,C snp 0.21 0.16 0.050 1.000 5 2011 2016
dbSNP: rs75873440
rs75873440
RET
7 0.784 0.179 10 43112173 missense variant G/A,T snp 4.4E-05 0.050 1.000 5 2009 2014
dbSNP: rs77316810
rs77316810
RET
9 0.784 0.143 10 43113654 missense variant T/A,C,G snp 0.030 1.000 3 1995 2015
dbSNP: rs77724903
rs77724903
RET
12 0.734 0.214 10 43118460 missense variant A/G,T snp 4.0E-06; 2.1E-03 2.6E-03 0.030 0.667 3 2010 2015
dbSNP: rs377767397
rs377767397
RET
5 0.846 0.143 10 43113628 missense variant G/A,C,T snp 0.020 1.000 2 2003 2015
dbSNP: rs377767398
rs377767398
RET
3 0.878 0.143 10 43113628 missense variant GC/AT,CT,TT multinucleotide-polymorphism 0.020 1.000 2 2003 2015
dbSNP: rs104894229
rs104894229
31 0.634 0.500 11 534289 missense variant C/A,G,T snp 0.010 1.000 1 2014 2014
dbSNP: rs11214077
rs11214077
6 0.821 0.107 11 112087953 missense variant A/G snp 6.6E-03 4.8E-03 0.010 < 0.001 1 2005 2005