Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
T | 0.800 | CausalMutation | CLINVAR | ||||||
|
A | 0.800 | CausalMutation | CLINVAR | ||||||
|
CG | 0.700 | CausalMutation | CLINVAR | ||||||
|
ACCT | 0.700 | CausalMutation | CLINVAR | ||||||
|
CTCT | 0.700 | CausalMutation | CLINVAR | ||||||
|
GGTCCCGCATGGCGCTGTACTC | 0.700 | CausalMutation | CLINVAR | ||||||
|
AG | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.840 | CausalMutation | CLINVAR | Carcinogen-induced mutations in the mouse c-Ha-ras gene provide evidence of multiple pathways for tumor progression. | 2105486 | 1990 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | rac, a novel ras-related family of proteins that are botulinum toxin substrates. | 2674130 | 1989 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Ras p21 proteins with high or low GTPase activity can efficiently transform NIH/3T3 cells. | 3004741 | 1986 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | The ras gene family and human carcinogenesis. | 3283542 | 1988 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | ras genes. | 3304147 | 1987 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Nucleotide sequence of the p21 transforming protein of Harvey murine sarcoma virus. | 6287572 | 1982 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Nucleotide sequence of the oncogene encoding the p21 transforming protein of Kirsten murine sarcoma virus. | 6287573 | 1982 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Characterization of the phosphorylation sites and the surrounding amino acid sequences of the p21 transforming proteins coded for by the Harvey and Kirsten strains of murine sarcoma viruses. | 6288698 | 1982 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Role of the switch II region in the conformational transition of activation of Ha-ras-p21. | 10716188 | 2000 |
|||
|
0.900 | GeneticVariation | UNIPROT | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
||||
|
T | 0.900 | CausalMutation | CLINVAR | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
|||
|
A | 0.840 | CausalMutation | CLINVAR | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
|||
|
G | 0.840 | CausalMutation | CLINVAR | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
|||
|
0.840 | GeneticVariation | UNIPROT | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
||||
|
0.830 | GeneticVariation | UNIPROT | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
||||
|
T | 0.810 | CausalMutation | CLINVAR | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
|||
|
0.810 | GeneticVariation | UNIPROT | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |
||||
|
0.810 | GeneticVariation | UNIPROT | Germline mutations in HRAS proto-oncogene cause Costello syndrome. | 16170316 | 2005 |